Sandokhan's Link and Post Collection

[Safranek]

Could you summarize what it says about lethal antibodies?

My take is that if you have inflammation or cancer cells in your body (which almost everyone has to some degree), then certain antibodies generated by your body against the 'coronavirus' will induce an auto-immune reaction against those damaged cells also.

 

[Jd755]

if you have inflammation or cancer cells in your body (which almost everyone has to some degree),

That is one hell of a statement. How did you determine this too be true, if you don't mind me asking.

 

[Safranek]

That is one hell of a statement. How did you determine this too be true, if you don't mind me asking.

I don't mind, though the answer should be self-evident.

Do people eat healthy and nutritious food?
Do they breathe clean air?
Do they exercise and keep their muscles and lymphatic system working optimally?

If the answer is no to any two of those, they will have a certain quantity of those types of cells in their body.

 

[Jd755]

I don't mind, though the answer should be self-evident.

Do people eat healthy and nutritious food?
Do they breathe clean air?
Do they exercise and keep their muscles and lymphatic system working optimally?

If the answer is no to any two of those, they will have a certain quantity of those types of cells in their body.

Thank you.
However I know of one chap who used to be a safety inspector in he shipyard where I worked. Healthy, fit as fiddle ran marathons. He went for an exploratory operation for some sort of complaint the docs couldn't figure out. They opened him up, looked in closed him back up. From that day where he found out he was 'riddled' with cancer and there is nothing they could do he lasted six weeks.
My wife developed thyroid cancer about 20 years ago and her thyroids were removed and she is with me today. Not overweight, eats reasonable food all supermarket but fresh as opposed to processed for the most part. Walks everywhere, always has she never learnt to drive.

This generalisation of "we all carry cancer cells within us" would hold merit if anyone knew what cancer was. I have no idea but cells mutating and somehow not being dealt with by the body which then suck out bodily resources and use them to kill the body is a best guess that underpins the pharmaceutical industry.
For that behemoth to endure there have to be treatments not cures, preaching to the choir here most likely but it bears repetition I feel.

As far as my research into cancer cures, they are legion, has gone diet, clean water, clean air, slow living more often than not, less stress, pulling out of a profoundly sick society and reducing and if it is possible within the individual avoiding processed sugar seem to be the things that do't allow cancer to prosper.
Cancer is a catch all pharmaceutical term as far as I can tell brought in to wrap a whole host of illnesses into one treatable "brand". Cancer. My money for what it is worth is on a mould or fungus being given the correct bodily conditions to explode its population and wreak havoc which results in the death of the body.

Apologies to Sandokhan for polluting your thread with my real world experiences but it seemed appropriate in this case.

Edit to add missing word.

 

[grav]

Unless and until you are able to properly explain why the bottle is crushed when it is brought to the surface, all other explanations (including density) are insufficient to describe gravity.

Why is density insufficient?

 

[Safranek]

Thank you.
However I know of one chap who used to be a safety inspector in he shipyard where I worked. Healthy, fit as fiddle ran marathons. He went for an exploratory operation for some sort of complaint the docs couldn't figure out. They opened him up, looked in closed him back up. From that day where he found out he was 'riddled' with cancer and there is nothing they could do he lasted six weeks.
My wife developed thyroid cancer about 20 years ago and her thyroids were removed and she is with me today. Not overweight, eats reasonable food all supermarket but fresh as opposed to processed for the most part. Walks everywhere, always has she never learnt to drive.

This generalisation of "we all carry cancer cells within us" would hold merit if anyone knew what cancer was. I have no idea but cells mutating and somehow not being dealt with by the body which then suck out bodily resources and use them to kill the body is a best guess that underpins the pharmaceutical industry.
For that behemoth to endure there have to be treatments not cures, preaching to the choir here most likely but it bears repetition I feel.

As far as my research into cancer cures, they are legion, has gone diet, clean water, clean air, slow living more often than not, less stress, pulling out of a profoundly sick society and reducing and if it is possible within the individual avoiding processed sugar seem to be the things that do't allow cancer to prosper.
Cancer is a catch all pharmaceutical term as far as I can tell brought in to wrap a whole host of illnesses into one treatable "brand". Cancer. My money for what it is worth is on a mould or fungus being given the correct bodily conditions to explode its population and wreak havoc which results in the death of the body.

Apologies to Sandokhan for polluting your thread with my real world experiences but it seemed appropriate in this case.

Edit to add missing word.

I also know of such a guy. Let's not forget that there is a spiritual aspect to our being which plays a significant role.

 

[sandokhan]

In fact, you don't need a train tanker, you can use a soda can:

Make Your Own Tanker Implosion With a Soda Can

Take a look at these images:

http://images.slideplayer.com/34/10210042/slides/slide_19.jpg

At the higher altitude, the antigravitational strings have a greater effect on the air inside the plastic bottle; at the lower elevation, the dextrorotatory receptive vortices of the atoms of air inside the container will be activated to a greater extent, practically causing the plastic bottle to implode.

The end result is the same.

In vacuum, once the air (gas subquarks) is pumped out, one is left with the pure potential, the ether drift with laevorotatory and dextrorotatory strings propagating in double torsion fashion.

Then, instantaneously, the dextrorotatory receptive vortices will absorb any aether left in the tanker/soda can/plastic bottle, causing a complete implosion of the object.

The train tanker is IMPLODING, and not crushing under the influence of the "atmosphere pressure".


Let us examine now an even more difficult example, the suction cup.

The force holding the suction cup comes from the string of subquarks which connect the surface of the cup with the surface of the body to which it is attached, as the cup recovers its shape aether is being withdrawn from the surface of the body, along with strings of subquarks, this is the reason for the force experienced. Barometers adjust to the ether atmospheric tide.

Now, the mathematical theory for the absorption/emission of aether through a Planck length level particle.

The paper was submitted in 1969, it took four years for the Journal of Mathematical Physics to verify that the equations are indeed correct.

http://euclid.colorado.edu/~ellis/RelativityPapers/EtFlThDrPaMoGeRe.pdf

Ether flow through a drainhole: a particle model in general relativity

Journal of Mathematical Physics, vol. 14, no. 1, 1973

In the case of the suction cup, the aether is blocked from the inside, not from the outside. As it is pressed against the surface, the aether is eliminated. As the object regains its shape, the aether will be provided by the laevorotatory subquarks of the surface itself.

When the center is pressed against the surface, the aether is eliminated. Now, as the cup resumes its original shape, the aether has to come from somewhere: the surface will emit the aether through the laevorotatory subquarks to fulfill this task. That is, the portion under the vacuum cup will become antigravitationally activated.

 

[sandokhan]

Now, we are in a very strong position to understand why things fall.

B. Riemann stated in 1853 that "gravitational aether sinks toward massive objects where it is absorbed, at a rate proportional to their mass, and is then emitted into another spatial dimension".


Downward motion provided by the shower of cosmic subquarks:

His belief at that time was that, to quote Westfall, ‘gravity (heaviness) is caused by the descent of a subtle invisible matter which strikes all bodies and carries them down'.

I. Newton

The rotational Ellis wormhole attains weight. The amount of aether that has been absorbed = finite weight attained. This occurs through the rotating wormhole.


https://arxiv.org/pdf/1409.1503.pdf

Rotating Ellis Wormholes in Four Dimensions

The rotating wormholes attain a finite mass and quadrupole moment.

Gravity is described by quantum entanglement Ellis wormholes.

These wormhole must rotate and must be traversable.

This is how an object attains weight.

These wormholes have throats on the order of the Planck length:

Cern Authentication (page 12)

All objects free fall at the same rate of acceleration regardless of their mass: π^2 m/s^2.

“This implies an important conclusion: bodies of different volumes that are in the same gradient medium acquire the same acceleration.

Note that if we keep watch on the fall of bodies of different masses and volumes in the Earth’s gravitation field under conditions when the effect of the air resistance is minimized (or excluded), the bodies acquire the same acceleration. Galileo was the first to establish this fact. The most vivid experiment corroborating the fact of equal acceleration for bodies of different masses is a fall of a lead pellet and bird feather in the deaerated glass tube. Imagine we start dividing one of the falling bodies into some parts and watching on the fall of these parts in the vacuum. Quite apparently, both large and small parts will fall down with the same acceleration in the Earth’s gravitation field. If we continue this division down to atoms we can obtain the same result. Hence it follows that the gravitation field is applied to every element that has a mass and constitutes a physical body. This field will equally accelerate large and small bodies only if it is gradient and acts on every elementary particle of the bodies. But a gradient gravitation field can act on bodies if there is a medium in which the bodies are immersed. Such a medium is the ether medium. The ether medium has a gradient effect not on the outer sheath of a body (a bird feather or lead pellet), but directly on the nuclei and electrons constituting the bodies. That is why bodies of different densities acquire equal acceleration.

Equal acceleration of the bodies of different volumes and masses in the gravitation field also indicates such an interesting fact that it does not matter what external volume the body has and what its density is. Only the ether medium volume that is forced out by the total amount of elementary particles (atomic nuclei, electrons etc.) matters. If gravitation forces acted on the outer sheath of the bodies then the bodies of a lower density would accelerate in the gravitation field faster than those of a higher density.

The examples discussed above allow clarifying the action mechanism of the gravitation force of physical bodies on each other. Newton was the first to presume that there is a certain relation between the gravitation mechanism and Archimedean principle. The medium exerting pressure on a gravitating body is the ether.”

A downward constant shower of subquarks (directionality), aether wormholes (weight, dextrorotatory terrestrial gravity), ether pressure (an object which receives pressurizing force from the strings of subquarks).

Therefore, Newton's law of gravity is a scientific concept describing the pressure exerted by the ether on two objects on the surface of the Earth. It cannot be applied to describe planetary orbits, or a supposed attractive gravitational force between the Earth and a body: Newton had to first PROVE heliocentrism, and in addition to prove that the shape of the Earth is spherical, which he never did.

As a matter of fact, Newton was pressed from all sides to provide an explanation for terrestrial gravity, that is why the second edition of the Principia, in the official chronology of history, includes the essay on the CAUSE of gravity.

“In attractions, I briefly demonstrate the thing after this manner. Suppose an obstacle is interposed to hinder the meeting of any two bodies A, B, attracting one the other: then if either body, as A, is more attracted towards the other body B, than that other body B is towards the first body A, the obstacle will be more strongly urged by the pressure of the body A than by the pressure of the body B, and therefore will not remain in equilibrium: but the stronger pressure will prevail, and will make the system of the two bodies, together with the obstacle, to move directly towards the parts on which B lies; and in free spaces, to go forwards in infinitum with a motion continually accelerated; which is absurd and contrary to the first law.”

the obstacle will be more strongly urged by the pressure of the body A


Newton's clear description again:

the obstacle will be more strongly urged by the pressure of the body A than by the pressure of the body B, and therefore will not remain in equilibrium: but the stronger pressure will prevail

Newton's Philosophy of Nature

Right from the pages of the Principia.

ATTRACTION = PRESSURE EXERTED FROM OUTSIDE PUSHING TWO OBJECTS TOGETHER

 

[grav]

Now, we are in a very strong position to understand why things fall.

B. Riemann stated in 1853 that "gravitational aether sinks toward massive objects where it is absorbed, at a rate proportional to their mass, and is then emitted into another spatial dimension".


Downward motion provided by the shower of cosmic subquarks:

His belief at that time was that, to quote Westfall, ‘gravity (heaviness) is caused by the descent of a subtle invisible matter which strikes all bodies and carries them down'.

Why do aether particles descend in the first place?
What is "down"?
There has got to be a better and simpler explanation of the whole process.

The only way I can understand the aether is as an infinite electric field.
The "subtle invisible matter" consists of positive and negative charges which combine in multidinous ways to form matter and energy. And consciousness.

I don't object to the left-right vortex movement idea, but that merely describes how. Not why.

As usual, jargon replaces clear language. wormholes and quarks?
I'm starting to doubt that Newton ever existed.

 

[sandokhan]

Now, the finishing touches. Why does the weight of a body equal zero in free fall?

Newtonian mechanics tries to explain this as follows: "It doesn't. The true weight--the gravitational force that the earth exerts on the object--remains." But, there is no attractive gravitational force exerted by the Earth upon a certain object. Why then does a body in free fall weigh nothing at all?

(here atoms = subquarks)

The object in free fall will weigh nothing (if it is attached to a scale, it will register zero) because the dextrorotatory strings will be detached temporarily from the body itself as it falls to the ground. The object's own dextrorotatory subquarks will not have the necessary time to form a connection with the dextrorotatory subquark field of the Earth (terrestrial gravity). Then, the only influence on the object (no wind, nor other pushing forces are applied) will be the vertical shower of subquarks which will impart directionality.

Charles F. Brush: Kinetic Theory of Gravitation

 

[Jd755]

The object in free fall will weigh nothing (if it is attached to a scale, it will register zero) because the dextrorotatory strings will be detached temporarily from the body itself as it falls to the ground. The object's own dextrorotatory subquarks will not have the necessary time to form a connection with the dextrorotatory subquark field of the Earth (terrestrial gravity).

I was just thinking that.

 

[sandokhan]

The g acceleration has a magical part.

g = π^2 = 4/sc^2 m/s2 (1 sc = 1 sacred cubit = 2/π)

On a flat surface of the Earth, the g force equals π^2 and is not related at all to the mass/radius of the Earth.

The rate of acceleration of a falling object, which acquires kinetic energy is a measure of energy flow via conduction through the ether.

Aetherometry and gravity: an introduction (section 3, Gravitational Pendulums, g related to π2)


Torricelli and the Ocean of Air: The First Measurement of Barometric Pressure

According to the official chronology of history, the effects of the "atmospheric pressure" upon a column of water of considerable height were measured as early as 1640 AD.

A column of water 32.381' (π^2 m) (cross-section 1 square inch) generates a pressure at the bottom of one atmosphere.

The magnitude of the value is exactly equal to that of the g acceleration.

Even if we take the value of 10.336 meters to be true, then 10.336/π^2 = 1.0472 which is exactly π/3!

Under the spherical Earth hypothesis, this is supposed to be just a random coincidence.

However, this fact cannot be true.

Modern science assumes that the proportions of the ingredients of the air (distribution of gases) have varied since the formation of the Earth, yet we are to believe that now the atmospheric pressure on a column of water will generate a height of the liquid in the glass tube of exactly π^2 m (the value of the g acceleration).

In addition, there is the atmospheric escape which takes place every year.

How could these random fluctuations in the chemical composition/mass of the Earth's atmosphere have lead to the precise value of π^2 m for the height of the water in the glass tube experiment?

In the flat earth theory, this fact is easily explained: the effect of the laevorotatory waves upon the column of water (π^2 meters) will equal exactly the magnitude of the value of the g acceleration (π^2).

The height of the liquid column does not rise because of atmospheric pressure. It is an extraordinary antigravitational effect and a proof of the existence of laevorotatory subquark strings.

The standard atmosphere, defined as being exactly equal to 101,325 pascals, is the reference value for the average atmospheric pressure at sea level. A torr is fixed by definition as being precisely equal to 1/760th of a standard atmosphere. The value of a millimeter of mercury is determined by: 1) the definition of gravity, 2) to the density of mercury (13.595 078(5) g/ml @ 0 °C, NIST value), and 3) to the temperature at which mercury's density is taken. However, the barometric pressure can vary by thousands of Pa in a single week.

The older concept of a technical atmosphere was phased out even though it worked very well in practice.

What is the unit called a technical atmosphere?

Using the technical atmosphere, we get 28.96 inHg and exactly 10 meters of water.

100,000/101,325 = π^2/10

The true gravitational acceleration at the Earth's surface corresponds to the gravitational field intensity E, and not to the net resultant acceleration, which varies with latitude.

"Traditionally, this field intensity is considered to be counteracted by the centrifugal force created by the Earth's rotation; the centrifugal acceleration is zero at the poles and reaches a maximum of 0.03392 m/s^2 at the equator. One of the problems in the current understanding of gravity is that the difference between the gravitational acceleration at the poles and at the equator is greater than any centrifugal reaction can account for. This discrepancy is conventionally explained by the Earth being not a perfect sphere but an oblate spheroid, or rather a triaxial spheroid.

Assuming that g = π^2m/s^2, and taking account of the centrifugal reaction, the value of g at the equator should be 9.83568 m/s^2, whereas the measured value is far lower: 9.780524 m/s^2. Modern technology permits more exact determinations of the measured values of net g at the poles and the equator, along with better determinations of the polar and equatorial radii. This makes it possible to accurately determine the angular velocity function (Ω) that is a constituent of the gravitational field intensity. It is pointed out that if we employ the values for net g at the poles (where no centrifugal reaction exists) along with the polar radii to determine the value of Ω, and then use this value together with the known equatorial radius to determine the gravitational field intensity at the equator, this will be found to be exactly π2m/s^2, to the fourth digit!

This rules out geometric explanations for the actual value of net g at the equator, as the differences in terrestrial geometry are already taken into account. So something besides the centrifugal force or geometry must account for the counteraction of gravity at the equator by Δ = (π^2 - 0.03392) - 9.780524 = 0.05516 m/s^2."

Therefore, this extra factor (which could be accompanied by other antigravitational factors to be accounted for) has to be substracted as well from the height of the column of water.

In the end, the magnitude of the true value of g, π^2, will equal the calculated height of the column of water, or be extremely close to it.

The mysterious antigravitational factor discovered by Dr. P. Correa is directly related to the effects exerted by the ether (its angular velocity).

The sacred cubit is designated in the form of a horseshoe projection, known as the "Boss" on the face of the Granite Leaf in the Ante-Chamber of the Pyramid. By application of this unit of measurement it was discovered to be subdivided into 25 equal parts known now as: Pyramid inches.

The value chosen in 1954 by the 10th Conférence Générale des Poids et Mesures (CGPM) for the standard atmosphere is directly related to the sacred cubit.

https://www.bipm.org/jsp/en/ViewCGPMResolution.jsp?CGPM=10&RES=4

1013250 dynes per square centimetre (101325 Pa).

4 x 101,325 = 405,300

405,300^(1/2) = 636.63176

2/π = one sacred cubit = 0.636619772

A four digit perfect match.

100,000/101,325 = 0.9869233

π^2/10 = 0.98696044

A four digit perfect match.

Dr. C. Goldblatt, one of the foremost experts on atmospheric physics in the world (Space Science and Astrobiology Division, NASA Ames Research Center) explains the total and complete random nature of the Earth's atmosphere evolution.

https://arxiv.org/pdf/1710.10557.pdf

Then, he explains these facts in the context of the faint young sun paradox:

https://www.clim-past.net/7/203/2011/cp-7-203-2011.pdf

"Geology has been viewed as a collection of events derived from insignificant causes, a string of accidents."

Yet, out of this string of accidents, we obtain a four digit perfect match between the value of the standard atmosphere and the magnitude of the g acceleration, and between the sacred cubit and the value of the standard atmosphere.

The main reason why the technical atmosphere (one kilogram-force per square centimeter) was phased out is connected in a direct way to the fact that by using this value, the figure for the column of water will be exactly 10 meters, a fact impossible to explain in the context of the random fluctuations of the atmosphere's chemical composition/mass.

980.665 mbar = 98.0665 kPa technical atm = 28.959136 inHg = 32.8093 ft of water = 10.00027464 m

The ratio 100,000/101,325 equals exactly π^2/10 (g acceleration divided by 10, the height of the column of water using the technical atmosphere).

In 1982, the International Union of Pure and Applied Chemistry (IUPAC) recommended that for the purposes of specifying the physical properties of substances, “standard pressure” should be precisely 100 kPa (1 bar) = 100,000 Pa.

http://goldbook.iupac.org/html/S/S05921.html


The missing apex of the Gizeh pyramid measures 286.1 sacred inches (7.2738 meters), where 286.1 = 450 sacred cubits, and 100 sc = 45 x 1.4134725, 141.34725 = the height of the Gizeh pyramid frustum.

727 Torr = 28.622156 inHg = 9.8839 m of water, a value very close to the g acceleration figure π^2 = 9.8696

How many inhg in 1 torr? The answer is 0.039370072825186.

One sacred inch = 0.025424 meters.

1/3.9370073 = 0.254


Now, here is another reason why the technical atmosphere was phased out.

https://www.sensorsone.com/kpa-to-mh2o-conversion-table/

The conversion factor from pascals to meters of water involves this value: 980,665 Pa (one technical atmosphere).

1/9.80665 = 0.1019716213

2/π = 0.636619772

32/100π = 0.10185916

0.1019716213 - 010185916 = 0.00011246129 = 2.861 x 0.0000393083852

1/3.93083852 = 0.2543986

0.2543986/4 = 0.063599661

Then, the conversion factor can be evidenced directly in terms of sacred cubits.

1013250 dynes per square centimetre (101325 Pa).

4 x 101,325 = 405,300

405,300^(1/2) = 636.63176

2/π = one sacred cubit = 0.636619772

101,325 = (2000/π)^2/4 + 6sc

Then, the value of the height of column of water, corresponding to 101,325 Pascals can be expressed directly in terms of sacred cubits.

 

[grav]

What part of TMI do you not understand?
An audience of amateurs need a simplification, not a long list of formulae and figures.

Have you seen this video? It examines the aether, free energy of the Tartarian empire, but not flat earth.
It is like Eawranon's work, long and complicated and in need of editing to improve continuity of thought.

View: https://www.bitchute.com/video/PTO0NvcDDLzl/

 

[sandokhan]

Behind Blue Eyes (The Who) is a modified version of one of the most haunting and mystical scores ever written, Khachaturian's Gayaneh:

www.youtube.com/watch?v=LQ7IHbluNsY

www.youtube.com/watch?v=dMrImMedYRo

The first side of Tommy (The Who) is better than anything else put forth by the Stones or by The Beatles (1969), certainly as impressive as Sgt. Pepper's Lonely Hearts Club Band. Led Zeppelin and Pink Floyd were not given material as good as the songs featured on the first side of Tommy.

www.youtube.com/watch?v=MKdusyjiuvY

Why does it sound so great?

Because the first two themes from the Overture are modified versions of von Weber's Hunter's Chorus:

www.youtube.com/watch?v=mRXL3gJdAHY

Adorno also used the theme from Tommy for Space Oddity (acoustic guitar part):

www.youtube.com/watch?v=iYYRH4apXDo (2:39-2:45)

Space Oddity is a modified Dear Prudence (given to The Beatles).

Dear Prudence includes two modified scores from Pictures At An Exhibition:

www.youtube.com/watch?v=kkC3chi_ysw (Gnomus and Cum Mortuis in Lingua Mortua)

Pinball Wizard is a modified version of Ippolitov-Ivanov's majestic Caucasian Sketches:

www.youtube.com/watch?v=KiF8JPARwCc

www.youtube.com/watch?v=4AKbUm8GrbM

Listening To You, one of The Who's greatest hits and anthems is a modified version of the second movement from Beethoven's 7th Symphony:

www.youtube.com/watch?v=Vi05EG6sTVQ

www.youtube.com/watch?v=ZqmC1T9rukk

The beautiful finale of Baba O'Riley is a modified version of the finale of Hello/Goodbye (The Beatles).

 

[sandokhan]

MERS-CoV-2

“While they were working on SARS-related coronavirus, they were carrying out a parallel project at the same time on MERS-related coronavirus”, referring to the virus that causes Middle East Respiratory Syndrome.

New Details Emerge About Coronavirus Research at Chinese Lab

MERS and H. Influenzae:

High frequency of Haemophilus influenzae associated with respiratory tract infections among Malaysian Hajj pilgrims

Influenza is more common than Middle East Respiratory Syndrome Coronavirus (MERS-CoV) among hospitalized adult Saudi patients

https://citeseerx.ist.psu.edu/viewdoc/download?doi=10.1.1.637.4817&rep=rep1&type=pdf

Questions raised by the "new" coronavirus


https://reliefweb.int/sites/reliefweb.int/files/resources/GPMB_annualreport_2019.pdf (pg 10 - September 2019)

"The United Nations (including WHO) conducts at least two systemwide training and simulation exercises, including one for covering the deliberate release of a lethal respiratory pathogen."

Henipah - Sars-Cov-2

You are being redirected...

Inhibition of Nipah Virus by Defective Interfering Particles

Nipah virus could evolve to spread globally, Stanford researcher says

Nipah virus, much deadlier than SARS-CoV-2, could be the next pandemic

Dr. L. Broxmeyer said that both encephalitis and meningitis are caused by mycobacterium, therefore nipah could also be a mycobacterium. HeLa cells and spike proteins can send electromagnetic copies of the cells of the mycobacterium to the bacteria in the atmosphere (this is how D614G got started back in january - march 2020, and how each and every VOI/VOC variant spread around the world), even though nipah is not fully airborne, and the possibility of a recombinant pathogenic agent is real.

 

[Safranek]

Inhibition of Nipah Virus by Defective Interfering Particles

Once again we have the same issue, the lack of isolation. You tend to ignore this significant aspect of virology and your point of view would have a lot more credence if you focused on this aspect.

Quote form the above article:

Cell Culture
Vero, Vero-E6, and BSR-T7/5 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 5% (v/v) fetal calf serum, nonessential amino acids, 1 mM sodium pyruvate, 2 mM L-glutamine, 100 U/mL penicillin, and 100 μg/mL streptomycin.

Furthermore,

NGS and Bioinformatics

Ribonucleic acid was extracted from cell culture supernatants (clarified by low-speed centrifugation) using the manufacturer’s TRIzol extraction protocol (Thermo Fisher Scientific) in combination with the DirectZol purification kit incorporating the in-column DNAse step (Zymo Research). RNA sequencing was performed using TrueSeq reagents and analyzed on the MiniSeq system (both from Illumina). Reads were mapped to the appropriate reference genome with in-house scripts by first removing Illumina adaptors (cutadapt version 1.8.3 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC; -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT --minimum-length = 1), trimming for low quality bases (prinseq-lite version 0.20.3 -min_qual_mean 25 -trim_qual_right 20 -min_len 50) and mapping to the appropriate reference genome with bwa-mem using default parameters (version 0.7.7). To determine NiV genome breakpoints and reinitiation points, chimeric reads were identified and characterized using a custom script, chimeric_reads.py v3.6.2 [25, 26]

Read the TRIzol extraction protocol and tell me if you think the RNA you have left after homogenization, subsequent treatments and analysis is likely of a purified virus.

Then there is the issue of the problems with the DirectZol purification kit. As you can see from that question/answer page regarding it, there are serious problems with it's use and its by far not a cut and dry technology.

Here's one of many papers that reflects the problems of isolation and why no virus has been proven to be isolated.

Nipah Virus Sequences from Humans and Bats during Nipah Outbreak, Kerala, India, 2018​

Abstract
We retrieved Nipah virus (NiV) sequences from 4 human and 3 fruit bat (Pteropus medius) samples from a 2018 outbreak in Kerala, India.

We attempted to isolate virus from 26 specimens from 9 Nipah-confirmed case-patients and 1 NiV-negative patient by processing throat swab, lung tissue, urine, and serum specimens in the Biosafety Level 4 laboratory of ICMR-NIV, as described previously (14) (Table 1). We inoculated 100 μL of each sample into a 24-well culture plate of Vero (ATCC, CCL-81) cells in 1 ml of Eagle minimal essential growth medium containing 10% fetal calf serum in each well. The culture plate was incubated at 37°C with 5% CO2. All culture fluid was passaged 4 times, irrespective of showing cytopathic effect. We adjusted urine sample pH to 7.4 using 1N sodium hydroxide before proceeding to virus isolation.

And then we have the 'scientific' conclusion:

Conclusions​

In this outbreak, NGS helped identify the circulating NiV in Kerala as B genotype. We found the highest similarity between human NiV complete sequences from Kerala and NiV N gene sequences from Pteropus spp. fruit bats (99.7%–100%), compared with NiV sequences reported from Malaysia, Cambodia, and Bangladesh (85.14%–96.15%). This finding indicates that Pteropus spp. bats were most likely the source for human infection in this outbreak.

Distinct clustering of Kerala sequences suggests that this strain may be circulating locally in bats and some evolution might exist that differentiates it from the northern Bangladesh/West Bengal strain. It may also suggest that the colony of bats sampled in this outbreak had active infection, but additional epidemiologic studies in bats may be needed to support this. Freeze–thawing of organs, lack of collection of fresh tissue samples in the field, or preserving tissues in virus transport medium might be the reasons for failure to retrieve the complete genome from bats.

I just selected one paper for you, and if you read between the lines, you'll find that all papers on isolation contain the same shady language. When something 'may be' or 'might exist', you can conclude that no absolute certainty exists, and if it doesn't exist, then why should we accept it as science?

Dr. L. Broxmeyer said that both encephalitis and meningitis are caused by mycobacterium, therefore nipah could also be a mycobacterium. HeLa cells and spike proteins can send electromagnetic copies of the cells of the mycobacterium to the bacteria in the atmosphere (this is how D614G got started back in january - march 2020, and how each and every VOI/VOC variant spread around the world), even though nipah is not fully airborne, and the possibility of a recombinant pathogenic agent is real.

And I haven't even mentioned 'plaque-purification' and 'purifying proteins from polyacrylamide gels' among other questionable methods used in isolation. When you read through the question/answer blog of Researchgate, you get better insight into the hit-and-miss approaches used by researchers (most of them with several papers already published) when applying these technologies. And then they peer-review and quote each other.

 

[sandokhan]

Two of the antibodies (against Sars-Cov-2) are lethal: REGN10987 and B38.

https://assets.researchsquare.com/files/rs-612103/v2_covered.pdf?c=1623875739

Rogue antibodies could be driving severe COVID-19

This is the key to understanding why, so far, many of the vaccinees (cmRNA/adenovirus) have not developed severe forms of Covid-19.

Since the genetic code for the cmRNA vaccines includes PSEUDOURIDINE (Pseudouracil) and not URACIL (mRNA), all of the resulting proteins will be ISOMERIC as well. Therefore, the S-abs (antibodies) will be ISOMERIC. That is, they have nothing to do with Sars-Cov-2, what they will accomplish is to overwhelm the immune system with binding-type antibodies (isomeric) which will diminish the production of the "natural" neutralizing abs (which of course will include the lethal abs REGN10987/B38 as well).

Had the vaccinees received A TRUE MRNA VACCINE, most of them would have been diagnosed with severe cases of Covid-19.

A reason to celebrate? Consider this:

1. Should a new pandemic arise (let's say Mers-Cov-2/H. influenzae), the same thing is going to occur: the "natural" neutralizing abs will be overwhelmed by the ISOMERIC ABS (antigenic sin phenomenon).

2. Should a new pathogenic agent with ISOMERIC PROTEINS arrive from the atmosphere (an isomeric Sars-Cov-2) there are going to be huge problems.

3. The reversal of the geomagnetic field will affect the ISOMERIC ABS.


"When this happens, the immune system has to rely on more specialized factors of our immune system (i.e., antigen-specific Abs and T cells) to fight the pathogen. So, as we grow up, we increasingly mount pathogen-specific immunity, including highly specific Abs. As those have stronger affinity for the pathogen (e.g., virus) and can reach high concentrations, they can quite easily outcompete our natural Abs for binding to the pathogen/virus. It is precisely this type of highly specific, high affinity Abs that current Covid-19 vaccines are inducing."

 

[sandokhan]

MERS-CoV-2

“While they were working on SARS-related coronavirus, they were carrying out a parallel project at the same time on MERS-related coronavirus”, referring to the virus that causes Middle East Respiratory Syndrome.

New Details Emerge About Coronavirus Research at Chinese Lab

MERS and H. Influenzae:

High frequency of Haemophilus influenzae associated with respiratory tract infections among Malaysian Hajj pilgrims

Influenza is more common than Middle East Respiratory Syndrome Coronavirus (MERS-CoV) among hospitalized adult Saudi patients

https://citeseerx.ist.psu.edu/viewdoc/download?doi=10.1.1.637.4817&rep=rep1&type=pdf

Questions raised by the "new" coronavirus


https://reliefweb.int/sites/reliefweb.int/files/resources/GPMB_annualreport_2019.pdf (pg 10 - September 2019)

"The United Nations (including WHO) conducts at least two systemwide training and simulation exercises, including one for covering the deliberate release of a lethal respiratory pathogen."

Henipah - Sars-Cov-2

You are being redirected...

Inhibition of Nipah Virus by Defective Interfering Particles

Nipah virus could evolve to spread globally, Stanford researcher says

Nipah virus, much deadlier than SARS-CoV-2, could be the next pandemic

Dr. L. Broxmeyer said that both encephalitis and meningitis are caused by mycobacterium, therefore nipah could also be a mycobacterium. HeLa cells and spike proteins can send electromagnetic copies of the cells of the mycobacterium to the bacteria in the atmosphere (this is how D614G got started back in january - march 2020, and how each and every VOI/VOC variant spread around the world), even though nipah is not fully airborne, and the possibility of a recombinant pathogenic agent is real.

Omikron = Mers-Cov-2. Both pathogenic agents use the DPP4 cellular receptor (also cathepsin),(unlike Sars-Cov-2 which utilizes ACE2 as a receptor). Both affect the bronchi. The main reason why the cmRNA vaccines no longer have any effect, is that we are dealing with a different pathogenic agent: omikron is Mers-Cov-2 and not a variant of Sars-Cov-2. The second reason is that we have reached the singularity point of the vaccines, the isomeric binding antibodies can no longer be created in the same amount as before (also T-cell exhaustion). In reality, Mers-Cov-2 is Haemophilus influenzae (not a virus, but a mycobacterium).

1915-1917 world wide "coronavirus" pandemic (actually M. avium)
1918 M. influenzae

If this is what happened, that means it had to evolve to bind to a mouse ACE2 receptor, which looks different from a human ACE2 receptor. In that case, the evasion of most human antibodies is primarily a side-effect of the fact that it had to change its Spike protein to fit a different looking ACE2 receptor.

If this is what happened, it’s a far worse scenario than the originally proposed scenario, of an infection in an HIV patient. The reason is because it means some of the changes it inherited from its time in mice that it still has right now are probably detrimental to its adaptation to humans. That may explain why it looks milder. That also means it’s probably going to lose those changes and become more severe in the coming weeks, as it continues to evolve.

In the scenario of the HIV patient, it simply gradually changed in response to an antibody response that wasn’t strong enough to eradicate it. That’s a more pleasant scenario, because it would mean the version of Omicron we’re seeing now wouldn’t have mutations that enhance replication in mice at the cost of replication in humans.

 

[6079SmithW]

Dude I think you're buying into the alophathic virology religion.

I don't think it's real myself

Look up project Immanuel

 

[Lightseeker]

What happened to Sandokhan's neverending thread?